Information on EC 2.7.7.6 - DNA-directed RNA polymerase. Adenylyltransferase) and EC 2.7.7.48 (RNA-directed RNA polymerase).
Results A long distance RT-PCR assay was developed to amplify the full length genome cDNA of EV71 by using specific primes carrying a SP6 promoter. Then the in vitro synthesized RNA transcripts from the RT-PCR amplicons were then transfected into RD cells to produce the rescued virus. The rescued virus was further characterized by RT-PCR and indirect fluorescent-antibody (IFA) assay in comparison with the wild type virus.
The rescued viruses were infectious on RD cells and neurovirulent when intracerebrally injected into suckling mice. Background Enterovirus 71 (EV71) is the major causative agent of hand, foot and mouth disease (HFMD), and may cause various neurological diseases, such as aseptic meningitis, acute flaccid paralysis and fatal encephalitis. In recent years, epidemic and sporadic outbreaks of neurovirulent EV71 infections have been reported throughout the world, representing a major public health concern. EV71 has become one of the most important enteroviruses known to cause fatalities in children. Therefore, understanding its virology, epidemiology, diagnosis, and prevention is of particularly importance.
EV71 belongs to human enterovirus species A of the genus Enterovirus within the family Picornaviridae, and it contains a single-stranded positive genome RNA of about 7,400 bp in length which is infectious when introduced into cell culture. The single open reading frame (ORF) encodes a polyprotein and is flanked by untranslated regions (UTR) at the 5' and 3' ends; a variable length poly-A tract is located at the terminus of the 3'UTR.
The polyprotein can be divided into three genomic regions (P1, P2 and P3). The P1 encodes the capsid comprised of four structural proteins VP1, VP2, VP3 and VP4. The P2 and P3 encode the nonstructural proteins including 2A, 2B, 2C, 3A, 3B, 3C and 3D. Reverse genetics permits the use of cDNA copies of viral RNA genomes to produce detailed studies of molecular features of virus infection and replication. The reverse genetic of picornaviruses has been developed for a long time. In 1981, Racaniello and Baltimore firstly demonstrated that the complete, cloned cDNA of the genome of poliovirus was infectious when transfected into permissive mammalian cells. Then, the infectious cDNA clones of coxsackievirus , hepatitis A virus , and so on were constructed, respectively.
Different strategies have been utilized by different groups worldwide to obtain the full length cDNA of viral genome. Long distance RT-PCR technology can amplify up to 10,000 nucleotides in a rapid strategy, which has been previously described to amplify the full length cDNA of different enteroviruses -. Thus, we are particularly interested to adapt this strategy into the study of the emerging enterovirus, EV71.
Here, we described a rapid strategy to amplify the full length cDNA of EV71 by long-distance RT-PCR using modified primers, and the RNA transcripts of amplicons were evidenced infectious in cell cultures and suckling mice. Results Firstly, to amplify the full-length genomic cDNA of EV71, a long-distance RT-PCR method was established and optimized. The SP6 promoter sequence was added to upstream of the upper primer to facilitate in vitro transcription. After optimization of RT-PCR conditions, chiefly through turning down annealing temperature from 55°C to 52°C or 50°C, the full-length cDNA of EV71 AH08/06 strain was successfully amplified (Fig ).
Electrophoresis showed the specific single DNA product band with the expected size of about 7.5 kb which could be easily purification for further in vitro transcription. The cDNA amplicons were then subjected to in vitro transcription by the SP6 in vitro transcription kit (Fig ). In vitro transcription of the full-length genomic cDNA of EV71. Lane 1: RNA transcripts; M: DL15000 Marker. Then, the above mentioned RNA transcripts were transfected to cultured RD cells, which is sensitive to EV71. Seventy two hours post transfection, the transfected cells and supernatants were collected, and RT-PCR and IFA were performed to identify the rescued viruses, respectively.
EV71-specfic RT-PCR results showed that the rescued virus had the specific band with the same size of the wile-type virus (Fig. ), and sequencing analysis showed that it originated from the parental viruses. Further, IFA results showed that VP1 proteins can be detected in rescued virus infected RD cells and demonstrated the rescued viruses could produce viral proteins with specificity to EV71 (Fig. IFA identification of the rescued virus. EV71 VP1-specific monoclonal antibody were used according to the standard protocol. Negative and positive controls were given. Further, the phenotypic properties of the rescued virus were compared with its parental virus.
Similar CPE were observed 24 h post infection such as cell rounding, aggregation, fall off and floatation, etc (Fig. After passage on RD cells for several generations, similar CPE phenomenon of the rescued viruses appeared repeatedly. Finally, the rescued virus were injected to one-day old suckling mice via the intracerebral route, and the mice showed typical neurological manifestation on 5 days after infection including debility, ataxia, paralysis with hind limb, etc and 20% of the infected mice finally died within 2 weeks. Discussion EV71 infection commonly results in mild HFMD and sometimes associated with severe neurological diseases, such as brain stem encephalitis and poliomyelitis-like paralysis especially in children. Currently, EV71 is becoming an important public health problem, especially in developing countries. In China, HFMD outbreaks caused by EV71 have been frequently reported since 2006, resulting in hundreds of deaths in children. The pathogenesis of EV71 infection is still not fully understood, and no antiviral drugs or vaccines have been approved for clinical use until now.
By using reverse genetics technology, specific mutations can be introduced into the full-length genomic cDNA, which will no doubt accelerate the understanding of pathogenesis and development of vaccine. Several amino acids or nucleotides mutations in EV71 genome have been identified critical for the neurovirulence of EV71 -. In these studies, the infectious clones of EV71 were constructed by ligation of two subgenomic clones, which utilized multiple RT-PCR and molecular clone steps.
Here, in this study, a convenient and efficient system to obtain the infectious full length genomic cDNA of EV71 has been established. This method deserves attention for several reasons: Firstly, full-length cDNA of EV71 can be easily obtained and sequenced by long distance RT-PCR techniques, which will forward the development of the reverse genetics of EV71. Secondly, virus preparations could be amplified directly from RNA samples, which is more safe and easy to transport or storage in comparison with the regular culture method.
Thirdly, mutations can be introduced into viral genome when amplification with specific primers; here SP6 promoter was introduced into the genome successfully and other promoters such as T7 or CMV promoters could also be added. Finally, this method is applicable to other enteroviruses such as coxsackievirus, echovirus, poliovirus and so on, most of which have similar genome. Actually, long distance RT-PCR technology has been previously described to amplify full-length cDNA of several enteroviuses -. Long template amplification was usually difficult because of many factors involved in PCR. To amplify the full length cDNA of EV71 genome, we designed primers about 50 nucleotides at length which is long enough for specific elongation with the 7.5 kb genome as template.
For the upper primer, we added the SP6 promoter for the subsequent transcription and restriction site as a marker that discriminate the amplified cDNA sequence from the normal genomic cDNA. Besides the primer specificity, reaction conditions are also key factors for successful amplification. The experiment results suggested that lower annealing temperature (52°C or 50°C but not 55°C) was suitable for long template PCR.
With specific primer pairs, optimized PCR parameters, and high fidelity enzymes, viral genome full-length cDNA were successfully amplified. Suckling mice injected with rescued viruses partly showed typical nervous system infection manifestation and dead subsequently, which demonstrated the rescued viruses were less neurovirulent than the parental viruses.
The neurovirulent difference between rescued virus and parental virus were not clear until now and need further investigation through infectious clone and in vitro mutation strategy. In conclusion, here we described a rapid method that rescued EV71 from RNA transcripts and rescued viruses could be infectious in vitro and in vivo, whose characterization is similar with the parental viruses. This method provides an easy way to engineer the viral genome and investigate the viral properties such as mutation, virulence, and so on. This is the first in the literature to demonstrate that EV71 could be rescued through long term PCR and infectious when inoculated into suckling mice.
Thus, the techniques reported here could be helpful for studies on enterovirus molecular biology and provide a useful tool for EV71 research. Full-length DNA amplification Full-length cDNAs of EV71 were acquired after long distance PCR using specific primers as follows: 5'-AGCTCC ACGCGTATTTAGGTGACACTATAGGTTAAAACAGCCTGTGGGTTGCACCCACTC-3' and 5'-AGCTCC TCTAGATTTTTTTTTTTTTTTTTTT TTTTTTGCTATTCTGG-3' (underlined words indicate restriction sites). Thirty five cycles of PCR amplification were carried out with the LA Taq™ Polymerase (TaKaRa) on an automated thermal cycler (Perkin Elmer). Temperatures were 94°C during denaturation (30 sec), 50°C during annealing (30 sec) and 70°C during polymerization (8 min).
The final extension time was 10 min at 72°C. The DNA products were purified using QIAquick PCR Purification Kit (QIAGEN) and further quantified on a NanoDrop Spectrophotometers (Thermo Scientific). In vitro transcription and transfection RNA transcription was carried out using the SP6 in vitro Transcription Kit (Promega) according to the manufactory's instructions.
The in vitro-synthesized RNA transcripts were then transfected into RD cells using Lipofectamine 2000 reagent (Invitrogen). Briefly, RD cells seeded in the 24-well plates with more than 90% confluency. Lipofectamine 2000 was diluted into OptiMEM Medium (Invitrogen) and incubated for 5 min following by mixture with the RNA transcripts for another 30 min at room temperature. Then the RNA-Lipofectamine 2000 complexes (50 μl) was added directly to the plate well of containing cells and incubate at 37°C in a CO incubator.
When cytopathic effect (CPE) was observed, the rescued viruses were harvested and stored at -70°C for use. RT-PCR The rescued virus was identified by RT-PCR with specific primers targeted at the VP3-VP1 genes (forward primer: 5'-GCAGCCCAAAAGAACTTCAC-3', reverse primer: 5'-ATTTCAGCAGCTTGGAGTGC-3'). The reaction parameters were as follows: 95°C during denaturation (20 sec), 45°C during annealing (25 sec) and 72°C during polymerization (30 sec) within 30 cycles. The final extension time was 10 min at 72°C. The DNA products were separated using QIAquick PCR Purification Kit and further verified by DNA sequencing (Invitrogen). IFA RD cells transfected with the RNA transcripts were grown on a specific slide.
RD cells were washed in PBS for 3 times and incubated with mice EV71 monoclonal antibody (Chemicon) in 1:1000 dilutions for 30 min at 37°C. Then the cells were washed and incubated with fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (Zhongshan) diluted 1:200 in Evans Blue for another 45 min. Finally, the cells were rinsed for 30 min in PBS and visualized under a fluorescent microscope (Olympus) after dried at room temperature. Bible JM, Pantelidis P, Chan PK, Tong CY.
Genetic evolution of enterovirus 71: epidemiological and pathological implications. Rev Med Virol. 2007; 17:371–379. Doi: 10.1002/rmv.538. Yang F, Ren L, Xiong Z, Li J, Xiao Y, Zhao R, He Y, Bu G, Zhou S, Wang J, Qi J. Enterovirus 71 outbreak in the People's Republic of China in 2008. J Clin Microbiol.
2009; 47:2351–2352. Doi: 10.1128/JCM.00563-09.
Qiu J. Enterovirus 71 infection: a new threat to global public health? Lancet Neurol. 2008; 7:868–869. Doi: 10.1016/S1474-447-2. McMinn PC.
An overview of the evolution of enterovirus 71 and its clinical and public health significance. FEMS Microbiol Rev. 2002; 26:91–107. Doi: 10.1111/j.1574-6976.2002.tb00601.x. Evans DJ.
Reverse genetics of picornaviruses. Adv Virus Res. 1999; 53:209–228. Racaniello VR, Baltimore D. Cloned poliovirus complementary DNA is infectious in mammalian cells. 1981; 214:916–919.
Doi: 10.1126/science.6272391. Martino TA, Tellier R, Petric M, Irwin DM, Afshar A, Liu PP.
The complete consensus sequence of coxsackievirus B6 and generation of infectious clones by long RT-PCR. 1999; 64:77–86. Doi: 10.1016/S0168-171-7. Tellier R, Bukh J, Emerson SU, Purcell RH.
Amplification of the full-length hepatitis A virus genome by long reverse transcription-PCR and transcription of infectious RNA directly from the amplicon. Proc Natl Acad Sci USA. 1996; 93:4370–4373. Doi: 10.1073/pnas.93.9.4370. Gow JW, McGill MM, Behan WM, Behan PO. Long RT-PCR amplification of full-length enterovirus genome. 1996; 20:582–584.
Leister D, Thompson R. Production of full-length cDNA from a picornaviral genome by RT-PCR. Trends Genet. Doi: 10.1016/S0168-954-0. Lindberg AM, Polacek C, Johansson S. Amplification and cloning of complete enterovirus genomes by long distance PCR.
J Virol Methods. 1997; 65:191–199. Doi: 10.1016/S0166-098-2. Lindberg AM, Andersson A. Purification of full-length enterovirus cDNA by solid phase hybridization capture facilitates amplification of complete genomes. J Virol Methods.
1999; 77:131–137. Doi: 10.1016/S0166-094-X. Cameron-Wilson CL, Zhang H, Zhang F, Buluwela L, Muir P, Archard LC. A vector with transcriptional terminators increases efficiency of cloning of an RNA virus by reverse transcription long polymerase chain reaction. J Mol Microbiol Biotechnol. 2002; 4:127–31. Lee TC, Guo HR, Su HJ, Yang YC, Chang HL, Chen KT.
Diseases caused by enterovirus 71 infection. Pediatr Infect Dis J. 2009; 28:904–910. Doi: 10.1097/INF.0b013e3181a41d63. Xu J, Qian Y, Wang S, Serrano JM, Li W, Huang Z, Lu S. EV71: an emerging infectious disease vaccine target in the Far East?
2010; 28:3516–3521. Doi: 10.1016/j.vaccine.2010.03.003. Arita M, Shimizu H, Nagata N, Ami Y, Suzaki Y, Sata T, Iwasaki T, Miyamura T. Temperature-sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys. 2005; 86:1391–1401. Doi: 10.1099/vir.0.80784-0. Arita M, Ami Y, Wakita T, Shimizu H.
Cooperative effect of the attenuation determinants derived from poliovirus sabin 1 strain is essential for attenuation of enterovirus 71 in the NOD/SCID mouse infection model. 2008; 82:1787–1797. Doi: 10.1128/JVI.01798-07.
Chua BH, Phuektes P, Sanders SA, Nicholls PK, McMinn PC. The molecular basis of mouse adaptation by human enterovirus 71. 2008; 89:1622–1632. Doi: 10.1099/vir.0.83676-0.
Kung YH, Huang SW, Kuo PH, Kiang D, Ho MS, Liu CC, Yu CK, Su IJ, Wang JR. Introduction of a strong temperature-sensitive phenotype into enterovirus 71 by altering an amino acid of virus 3D polymerase. 2010; 396:1–9. Doi: 10.1016/j.virol.2009.10.017. Hawkins PR, Jin P, Fu GK.
Full-length cDNA synthesis for long-distance RT-PCR of large mRNA transcripts. 2003; 34:768–70. Thiel V, Herold J, Siddell SG.
Long distance reverse-transcription PCR. Methods Mol Biol.
2002; 192:59–66. Chen YC, Yu CK, Wang YF, Liu CC, Su IJ, Lei HY. A murine oral enterovirus 71 infection model with central nervous system involvement. 2004; 85:69–77. Doi: 10.1099/vir.0.19423-0.
Xin Li, Mengmeng Li, Jing Wen, Tingdong Fu and. National Key Laboratory of Crop Genetic Improvement, National Subcenter of Rapeseed Improvement in Wuhan, Huazhong Agricultural University, Wuhan, China Small peptides secreted to the extracellular matrix control many aspects of the plant’s physiological activities which were identified in Arabidopsis thaliana, called ATSPs. Here, we isolated and characterized the small peptide gene Bna.SP6 from Brassica napus. The BnaC.SP6 promoter was cloned and identified. Promoter deletion analysis suggested that the -447 to -375 and -210 to -135 regions are crucial for the silique septum and pollen expression of BnaC.SP6, respectively. Furthermore, the minimal promoter region of p158 (-210 to -52) was sufficient for driving gene expression specifically in pollen and highly conserved in Brassica species. In addition, BnaA.bZIP1 was predominantly expressed in anthers where BnaC.SP6 was also expressed, and was localized to the nuclei.
BnaA.bZIP1 possessed transcriptional activation activity in yeast and protoplast system. It could specifically bind to the C-box in p158 in vitro, and negatively regulate p158 activity in vivo. BnaA.bZIP1 functions as a transcriptional repressor of BnaC.SP6 in pollen activity. These results provide novel insight into the transcriptional regulation of BnaC.SP6 in pollen activity and the pollen/anther-specific promoter regions of BnaC.SP6 may have their potential agricultural application for new male sterility line generation. Introduction In flowering plants, pollen grains, which are required for successful fertilization, are formed by meiosis in microsporocyte and mitosis in pollen (; ). The seeds and fruits derived from double fertilization of flowering plants are major components of human diet.
With the increasing human population and changes in the global climate, breeders are faced with the challenge of developing new hybrid varieties for sustained food supply. In F1 hybrid seed production, the “two-line system” has shown a greater potential after the “three-line system” reached a yield plateau.
This observation has also been made in Brassica napus, the hybrid seeds of which are widely used commercially in China. Male sterility through genetic engineering is the most effective strategy for improving yields by producing fertile F1 hybrids. This can be achieved by inhibiting the normal endogenous hormone biosynthesis or by combining the pollen/anther-specific promoter with the genes of appropriate enzymes or toxin proteins so as to restrict the development of reproductive tissues (; ).
Thus, identification of the pollen/anther-specific promoter is necessary for successful genetic manipulation. Many pollen/anther-specific promoters have been cloned and characterized from various plant species; these include the SBgLR promoter from potato, OSIPA promoter from rice, and Zm908 promoter from maize (;; ). Moreover, some cis-acting regulatory elements have been delineated by deletion scanning and by changing the cis-acting elements (; ), such as the POLLEN1LELAT52, GTGA MOTIF, and TTTCT (;; ). However, the presence of these pollen-specific cis-elements does not equal to a promoter’s pollen specificity. Only a few trans-acting factors, such as atDUO1, γMYB1 and γMYB2, and ZmDof30, which interact with the pollen-specific promoters, have been confirmed (;; ). Plant bZIP transcription factors (TFs) are characterized by a leucine zipper and a basic region, which is responsible for the specific binding to various ACGT-containing elements in the promoters. They are classified as A-box, C-box, G-box, or T-box according to the nucleotide at position +2 (the central two nucleotides C and G are designated as -0 and +0, respectively), among which C and/or G-boxes are preferentially bound by plant bZIP proteins.
In Arabidopsis, 75 bZIP TFs were subdivided into 10 groups named A to I, and S, based on sequence similarities and functional features. Identified 17 bZIP genes possessing a mean expression signal in pollen over 400 in the Affymetrix Arabidopsis ATH1GeneChip, including AtbZIP1, AtbZIP18, AtbZIP34, AtbZIP52, and AtbZIP61. Furthermore, they demonstrated that AtbZIP18 interacted with AtbZIP34, AtbZIP52, and AtbZIP61 in Y2H assays.
The pollen of atbzip18 showed similar morphological defects but with different percentage compared to atbzip34 pollen which appearing misshapen and misplaced nuclei in the cytoplasm. Further pollen microarray analysis indicated that they are functional redundancy in pollen and the potential pollen-expressed repressor role of AtbZIP18. AtbZIP1, an S-group member of bZIP TFs, was confirmed to be expressed highly in various tissues including pollen and silique valve. AtbZIP1 is involved in sugar signaling, nutrient signaling, protein network integration, and DNA binding (; ). These facts imply that their Brassica ortholog genes, BnbZIPs, may be involved in the transcriptional regulation network of pollen development in B. Many genes encoding putative small peptides have been identified in plants by genomic study and multi-omics analysis in recent years (;; ).
In maize, Zm908p11, a gene predominant in pollen, was identified; this gene encodes a 97-amino-acid (a.a.) peptide that functions in pollen tube growth as a profilin ligand. In Arabidopsis, 152 putative small secreted protein genes that encode proteins possessing a signal peptide at N terminal, and are composed of less than 100 a.a. Residues, are defined as ATSPs. One unannotated ATSP member, ATSP6, was demonstrated to express weakly in root elongation zone and meristem by promoter-GFP analysis. Based on e-FP Browser data, ATSP6 exhibits high expression levels in mature pollen and encodes a protein that is yet unidentified. As of date, no studies have reported the biological function of Bna.SP6 in B.
Napus, which is a homolog of ATSP6. In this study, we characterized the important regions in pBnaC.SP6 and identified a trans-factor of BnaC.SP6 using different assays. Our findings could help in better understanding of the regulation of BnaC.SP6 at the transcription level in pollen activity. Materials and Methods Plant Materials Brassica napus “ZS11” and a near-isogenic line “S45AB” were sown at the experimental station of Huazhong Agricultural University (Wuhan, China) under natural conditions. Arabidopsis thaliana Col-0 was grown in plastic pots containing soil mixture (nutrient soil:roseite = 3:1) in a greenhouse at 22°C and under 16-h/8-h light/dark photoperiod. RNA Isolation and RT-PCR Leaves, stems, whole inflorescence, flower buds (1.5, 2.5, 3.5, 4.5, 5.5, and 6.5 mm), opening anthers, and siliques (2, 11, and 29 dap) were collected from ZS11 plants; only buds without stamens were collected from S45A plants.
Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, United States). The first-strand cDNA was then synthesized by reverse transcription and Bna.SP6 transcript was amplified using Bna.SP6-F and Bna.SP6-R primers (Supplementary Table S1) with 32 cycles. Ubiquitin-associated (UBA) protein gene BnUBA was amplified as a control (Supplementary Table S1). Gene Cloning and Sequence Analysis The genomic DNA of BnSP6C08 (611 bp) and BnSP6A08 (475 bp), the pBnaC.SP6 (1167 bp), and the full-length CDS of Bna.SP6 (246 bp) was amplified with specific primers (Supplementary Table S1) and sequenced. The Bna.SP6 CDS sequences were translated to their respective peptide sequences using Primer Premier 5 software. The potential cis-acting elements in pBnaC.SP6 were predicted using the PlantCARE program.
The presence and location of signal peptide cleavage sites in the amino acid sequences were predicted by SignalP 4.1 server. Construction of Promoter Reporter Plasmids All the plasmids used for GUS assay were constructed in the backbone of pCAM2300-H2BYFP-gusplus-Nost vector.
The H2BYFP-GUSplus-Nost fragment was restricted from pG2NHL-H2BYFP-GUSplus-Nost plasmid by KpnI and EcoRI and ligated into pCAM2300. A series of fragments with 5′-deletion in the promoter were amplified using different forward primers (p647F, p447F, p375F, p306F, p210F, and p135F) and a single reverse primer, Pro-1R. The full-length promoter and six 5′-deleted derivatives were cloned at SalI and SmaI sites in the pCAM2300-H2BYFP-GUSplus-Nost vector and the resulting constructs were designated as pBnaC.SP6, p647, p447, p375, p306, p210, and p135, respectively. In addition, two 3′-deletions containing the regions from -306 to -52 and -210 to -52 were amplified using two forward primers (p306F and p210F) from the upstream region and a single reverse primer (Pro-d52R) from the downstream region. They were cloned into the pCAM2300-H2BYFP-GUSplus-Nost vector and the resulting constructs were designated as p254 and p158. The primers used are shown in Supplementary Table S1. Stable Transformation of Arabidopsis and Segregation Analysis of Transgenic Plants Col-0 plants were transformed with recombinant Agrobacterium tumefaciens GV3101 strain, harboring the promoter:H2BYFP-GUSplus construct, by floral dip method.
Seeds from the wild-type were germinated on agar plates containing half-strength Murashige and Skoog’s medium (12 MS), with 1% (w/v) sucrose, 0.7% (w/v) agar at pH 5.8, and supplemented with kanamycin (50 mg l -1) and timentin (75 mg l -1). Thereafter, we randomly selected 100–160 seeds of each T 1 line to perform the segregation analysis. The kanamycin-resistant lines showing 3:1 segregation pattern were further carried onto the next generation to obtain homozygous lines.
Three such homozygous lines were used for quantitative GUS activity assay. Chi-square values were calculated by the corrected formula χ C 2 = Σ ( O − E − 1 / 2 ) 2 / E, where O and E are the observed and expected values, respectively. The probability was calculated with two-degrees-of-freedom based on Chi-square distribution table. Histochemical GUS and DAPI Staining Assays The histochemical GUS and 4′,6-diamidino-2-phenylindole (DAPI) staining assays were performed as described by and, respectively. Different tissues from heterozygous transgenic lines were stained overnight in X-Gluc solution. Thereafter, the chlorophyll was cleared out of the samples using 70% ethanol. Images of various tissues were taken using an Olympus DP72 Digital Microscope Camera.
GUS-stained flower buds were embedded in Technovit 7100 resin, as described previously. Subsequently, transverse sections of the anthers (approximately 8 μm thick) were cut from the embedded blocks using a Leica Ultracut R ultramicrotome. The GUS-stained anthers were incubated at 60°C for 1 h in a DAPI staining solution containing 20% methanol and 1.0 μg ml -1 of DAPI. The images were taken using a Nikon ECLIPSE 80i microscope. Quantification of GUS Activity Arabidopsis flower buds (flower development stage 12–15) of homozygous transgenic lines were collected for quantitative measurement of GUS activity according to the protocol described. Total proteins were extracted from the buds and the protein concentration was determined by the Bradford method. The GUS assay buffer containing the substrate, 4-methylumbelliferyl-β-d-glucuronide (MUG), was added to the protein samples and the reaction was incubated for 30 min at 37°C.
The resulting fluorescence was recorded using Tecan Infinite M200 PRO (Tecan Group Ltd., Switzerland). The relative GUS activities were calculated and expressed as nmole 4-MU generated per min per milligram of the total protein.
Yeast One-Hybrid and Transcriptional Activation Assay in Yeast A Y1H assay was performed as mentioned in the manual of Matchmaker Gold Yeast One-Hybrid Library Screening System (Clontech). As the baits, pAbAi-p158, pAbAi-mp158, and pAbAi-p99 (part of p158, containing only the ABRE motif) were transformed into the Y1HGold yeast strain. Then the pGADT7-BnaA.bZIP1 fusion plasmid was introduced into three bait strains, respectively. The co-transformed yeast cells were cultured on SD/-Leu agar plates with or without AbA and incubated at 30°C for 3 days. P53 was used as a positive control. PGBKT7-BnaA.bZIP1 and pGBKT7-atbZIP1 fusion plasmids were introduced into yeast reporter strain AH109 (Clontech). The transformants were transferred onto a filter paper and incubated at 30°C for 3–5 h in the presence of X-Gal to check the β-galactosidase activity by monitoring the generation of blue color.
The primers used are shown in Supplementary Table S1. Electrophoretic Mobility Shift Assay The pET-32a-BnaA.bZIP1 recombinant plasmid was transformed into Escherichia coli BL21 cells. The recombinant fusion proteins were purified using Ni-NTA His.Bind ® Resin (Novagen). The complementary oligonucleotides (p59 and mp59) containing the consensus DNA-binding site C-box (CACGTC) and mC-box (Ctatga) were, respectively, annealed and used as DNA probes.
The DNA–protein binding reactions were performed in a total volume of 10 μl, containing 5 μl BnaA.bZIP1-His or pET-32a-His protein, 2 μl 5× EMSA/Gel-shift-Binding Buffer (Beyotime Biotechnology, China), 30 nM Cy5-labeled probe, and 200- to 800-fold molar excess of unlabeled competitor. The reaction mixture was incubated for 30 min at 25°C. The electrophoresis was performed with 6% non-denaturing polyacrylamide gel and carried out in 0.5× TBE (45 mM Tris base, 45 mM boric acid, 0.5 mM EDTA, pH 8.3) at 4°C in a vertical electrophoresis system.
The reaction mixture was loaded and electrophoresis was performed at 10 mA until the dye front migrated through 50% of the length of the gel. The gels were scanned to detect the fluorescent DNA using Fujifilm FLA-9000 plus DAGE (FujiFilm, Japan).
The primers used are shown in Supplementary Table S1. Analyses of BnaA.bZIP1 Transcriptional Activation/Repression and DNA Binding in Arabidopsis Protoplasts The dual luciferase reporter (DLR) assay was performed as described.
The full-length BnaA.bZIP1 (139 a.a.), two C-terminal deletions (BnaA.bZIP1ΔC1, 114 a.a. And BnaA.bZIP1ΔC2, 89 a.a.) of BnaA.bZIP1, and AtbZIP1 (145 a.a.) restricted with XbaI and BamHI were inserted into pBDGAL4 vector as effectors. Luciferase (LUC) driven by the CaMV35S promoter was used as a reporter. The Renilla LUC gene driven by the Arabidopsis UBIQUITIN3 (AtUBI3) promoter was used as an internal control. In addition, the pGreenII 62-SK and pGreen II 0800-LUC transient expression system was employed as described. BnaA.bZIP1 restricted with BamHI and XhoI was inserted into the pGreenII 62-SK vector as the effector.
The fragments p158, mp158, p103 (part of p158, containing only the C-box), and mp103 restricted with SalI and SmaI were inserted into the pGreen II 0800-LUC vector as reporters. The effector and reporter constructs were co-transformed into Arabidopsis protoplasts by polyethylene glycol (PEG)/calcium-mediated transformation. After transfection, the luminescence from firefly LUC and Renilla LUC were recorded on a Tecan Infinite M200 PRO.
The primers used are shown in Supplementary Table S1. Expression Pattern and Subcellular Localization of BnaA.bZIP1 The BnaA.bZIP1 transcript was detected by quantitative real-time PCR (qRT-PCR) on a CFX96 Real-Time System (Bio-Rad, United States). The expression data were calculated using the 2 -ΔΔ C t method.
Each sample was assayed in triplicate. The 1317-bp promoter region (pBnaA.bZIP1) of BnaA.bZIP1 restricted with SalI and BamHI was inserted into the pCAM2300-H2BYFP-GUSplus-Nost vector. The pM999-CFP-GHD7 plasmid was used as a nuclear marker.
The full-length CDS of BnaA.bZIP1, without the termination codon, restricted with XbaI, was inserted into the pM999-GFP vector. The preparation of Arabidopsis mesophyll protoplasts and their subsequent transfection was done as described above. The fluorescence signals were measured using a FV1200 Laser Scanning Microscope. The primers used are shown in Supplementary Table S1. Dexamethasone (DEX) Treatment The fusion protein of full-length BnaA.bZIP1 with a 3XFlag-tag at the N-terminal was cloned into pTA7002 vector.
The vector construct was transformed into p158 transgenic line. T 2 plants harboring BnaA.bZIP1 and p158 fragments were grown on soil and treated with DEX (Sigma–Aldrich, United States) at the flowering stage. Water (10 ml) containing 15 nM DEX was applied daily for 5 days to the soil. The day of first DEX treatment was recorded as 1 days. Buds (with p158 activity) were collected from T 2 plants on 0, 4, and 6 days after the DEX treatment.
RNA extraction and qRT-PCR were performed as described above and Actin7 was used as the reference. The primers used are shown in Supplementary Table S1.
Results Small Peptide Gene BnaC.SP6 Was Expressed in Mature Anthers and Silique Septum AT1G19500 belongs to small secreted protein gene family and named ATSP6. Two ATSP6 homologs, BnSP6C08 and BnSP6A08, were cloned from B. Napus “ZS11.” BnSP6C08 was observed to have a significantly longer intron than that present in its paralog, BnSP6A08 (Figure ). Their coding sequences (CDS) were also cloned from the opening anthers of “ZS11” and designated as BnaC.SP6 and BnaA.SP6. Sequence alignment showed that BnaC.SP6 and BnaA.SP6 only had five mismatches in their CDS sequences.
They encoded 81-a.a. Peptides containing putative signal cleavage sites between residues 25 and 26, and had not any discernable motif (Figure ). Thus, we used the cloning primers to analyze the full-length transcripts of Bna.SP6 ( BnaC.SP6 and BnaA.SP6) by RT-PCR in different organs. The result revealed that Bna.SP6 existed high expression levels in whole inflorescence, opening anthers, and 29 dap (dap, day after artificial pollination) siliques. The expression levels were low in 5.5 and 6.5 mm buds, and 11 dap siliques; however, the expression was rarely detected in 1.5, 2.5, 3.5, and 4.5 mm buds, 2 dap siliques, buds without stamens, leaves, and stems (Figure ). Structural analysis of the small peptide gene Bna.SP6 in Brassica napus.
(A) Schematic of BnSP6C08 and BnSP6A08 gene structures. Exons and intron are indicated by black boxes and gray line, respectively.
(B) Alignment of the deduced amino acid sequences of BnaC.SP6 and BnaA.SP6. The signal peptides are indicated by thin black lines under the corresponding residues.
(C) Detection of Bna.SP6 transcript in B. Napus by RT-PCR. Buds were 1.5, 2.5, 3.5, 4.5, 5.5, and 6.5 mm length; 2, 11, and 29 dpi, siliques 2, 11, and 29 days after artificial pollination. In the core promoter region, pBnaC.SP6 shared 95.7% nucleic acid identity with pBnaA.SP6. So pBnaC.SP6 (1167 bp) was selected for further analysis. PBnaC.SP6 (1167 bp) was fused to GUS reporter gene, and was introduced into wild-type Arabidopsis (Col-0) plants.
Whole plant (14-days-old), cauline leaves, whole inflorescence, flower buds, and siliques (5 and 10 mm) of transgenic lines were evaluated by GUS staining. PBnaC.SP6 showed no GUS expression in the vegetative organs, such as root and rosette leaf of 14-day-old plant. During the reproductive phase, GUS expression was observed in the anthers at flower developmental stages 11–15. Also, GUS expression was observed in the silique septum of 5 mm siliques but not in the seeds and valves (Figure ).
This could be the reason as to why Bna.SP6 transcript was rarely detected in 2 dap siliques using RT-PCR (Figure ). These results indicated that BnaC.SP6 encoded a small peptide and expressed in mature anthers and silique septum. Histochemical GUS assay of pBnaC.SP6 and its deletions in transgenic Arabidopsis. GUS expression was analyzed in various tissues of transgenic Arabidopsis, namely whole plant (14-d-old), cauline leaves, whole inflorescence, flower buds, and siliques (5 and 10 mm). Black arrows indicate the silique septum.
Bars, 1 mm (whole plant, cauline leaves, whole inflorescence, and siliques); 500 μm in the case of flower buds. (A–H) pBnaC.SP6 and its truncations (p643, p447, p375, p306, p210, p254, and p158) are shown, respectively.
Two Short Promoter Regions Independently Control the Silique Septum and Pollen Expression of BnaC.SP6 Motif search using PlantCARE revealed that the pollen-specific activation-related element POLLEN1LELAT52, LAT enhancer element, and GTGA MOTIF are located in pBnaC.SP6, which might help drive the expression of BnaC.SP6, predominantly in pollen of mature anthers (Supplementary Figure S1). Some known cis-elements, such as P1BS, C-box, ABRE motif, Skn1-motif, and DOFCOREZM, were also detected. In addition, a potential TATA-box sequence was located at the position -136 (Supplementary Figure S1). Some of these elements, such as DOFCOREZM and C-box, were located around the basic promoter element, the TATA-box, and are likely to be required for the high levels of expression of BnaC.SP6 in the developing reproductive organs. To identify functional regions in pBnaC.SP6 (p1167), a series of promoter deletions (p643, p447, p375, p306, p254, p210, p158, and p135) cassettes were introduced into Col-0 (Supplementary Figure S2A). With 5′- and 3′-deletion constructs, GUS expression could still be detected in mature anthers (Figures ); however, p135 failed to show GUS activity in any of the organs tested (data not shown). P158, containing the region from -210 to -52, showed pollen-specific GUS activity, indicating that the -210 to -135 region was crucial for the expression of BnaC.SP6 in pollen whereas the -52 to -1 region was not necessary (Figure ).
Interestingly, only p643 showed weak GUS expression in the cotyledon (Figure ). When the -447 to -375 region was missing from p447, no GUS expression was observed in the silique septum (Figures ). This suggested that the -447 to -375 region was important for the silique septum activity of pBnaC.SP6. Characterization of the Pollen-Specific Activity of p158 The pollen-specific activity of p158 in developing pollen was determined using semi-thin anther sections and DAPI staining. Obvious GUS staining was first detected in the early bicellular pollen at the anther development stage 12 (Figures ).
At stage 13, the GUS expression reached its maximal level in the tricellular pollen, and declined gradually in the pollen grains until mature pollen grains were released (Figures ). Similar results were obtained by staining the anthers with DAPI. The blue-fluorescing DAPI-stained nucleic acids were clearly detectable under ultraviolet illumination in the early bicellular, tricellular, and mature pollen (Figures ). Therefore, p158 could specifically drive the GUS expression from early bicellular pollen to mature pollen stage. To determine the GUS activity driven by different promoter deletions of BnaC.SP6, quantitative GUS assays were performed after segregation analysis (Supplementary Table S2). As expect, p158 showed the minimum GUS activity in comparison to those obtained with other deleted BnaC.SP6 promoters (Supplementary Figure S2B).
The p158 region was also amplified and sequenced from B. Juncea, and B. They shared 100% nucleic acid identity with the B. Napus p158, suggesting that the pollen-specific activity of p158 was highly conserved in these species (Supplementary Figure S3). These results indicated that the minimal promoter p158 was required for late pollen-specific expression of BnaC.SP6 and highly conserved in Brassica species.
Expression Pattern of BnaA.bZIP1 and Its Function as a TF Quantitative real-time PCR analysis showed that BnaA.bZIP1 was predominantly expressed in flower buds and at low levels in stems, leaves, and 2, 11, and 29 dap siliques (Figure ). To obtain further insights into the expression pattern of BnaA.bZIP1 in developing flowers, the pBnaA.bZIP1 reporter construct was transformed into Col-0 plants and histochemical GUS assay was performed. During flower development, the initial GUS activity was specifically detected in the anthers at flower stages from 9 to 12. From stages 13 to 15, GUS expression was also observed in the stamen filaments and perianths (Figure ).
These suggested that BnaA.bZIP1 was dynamically expressed in floral organs and coexpressed with BnaC.SP6 in anthers. Therefore, the full-length CDS of BnaA.bZIP1 were cloned from opening anthers. It contained a CDS of 420 bp, which encoded a 139 a.a. Protein with a basic leucine zipper (bZIP) DNA-binding and dimerization domains localized between residues 17 and 68. The overall amino acid sequence identity between BnaA.bZIP1 and AtbZIP1 was 78.77% (Supplementary Figure S4).
To determine the subcellular localization of BnaA.bZIP1, a vector pM999-BnaA.bZIP1-GFP was constructed by fusing GFP to the C-terminus of BnaA.bZIP1. We observed that the GFP signal coincided with the CFP signal of a previously characterized nuclear marker CCT domain protein (OsGHD7), indicating that BnaA.bZIP1 is a nuclear-localized protein (Figure ).
Expression pattern, subcellular localization, and the transcriptional activation activity of BnaA.bZIP1. (A) Expression levels of BnaA.bZIP1 in diverse tissues as assessed by qRT-PCR.
Error bars indicate the SD and were calculated from three biological replicates. 3.5B, 0–3.5 mm buds; 6.5B, 3.5–6.5 mm buds; the other tissues are as mentioned in Figure. (B) GUS expression in developing flower of pBnaA.bZIP1 transgenic lines. Bars, 500 μm (flower buds), 1 mm (whole inflorescence), and 100 μm in the case of stamen. (C) Subcellular localization of BnaA.bZIP1. The fusion plasmid (pM999-BnaA.bZIP1-GFP) and a nuclear marker plasmid (pM999-CFP-GHD7) were co-transformed into Arabidopsis protoplasts.
Scale bars = 10 μm. (D) Assay for the transcriptional activation of BnaA.bZIP1 in yeast cells.
The pGBKT7-AtbZIP1 and pGBKT7 were used as positive and negative controls, respectively. (E) Schematic diagrams of the constructs used for the transient expression assay in Arabidopsis protoplasts. The full-length and two C-terminal deletions of BnaA.bZIP1 were fused with GAL4BD. The pGAL4BD and pBD-AtbZIP1 were used as negative and positive controls, respectively. (F) The transcriptional activation abilities of effectors were determined by the ratio of LUC to REN, which was obtained from the co-transformation of protoplasts with the effector and reporter plasmids ( n = 3).
The value of the negative control was set to 1. Error bars represent the SE of three biological replicates.
It had been suggested that AtbZIP1 functions as a transcriptional activator in yeast and its C-terminus is important for the transactivation activity. To investigate whether BnaA.bZIP1 has the similar activity as that of AtbZIP1, pGBKT7-BnaA.bZIP1, pGBKT7-atbZIP1, and pGBKT7, plasmids were separately transformed into the yeast strain AH109. All the transformants could grow well on the SD/-Trp medium, but on SD/-Trp-His medium only the yeast cells containing pGBKT7-BnaA.bZIP1 and pGBKT7-AtbZIP1 grew well.
Consequently, the pGBKT7-BnaA.bZIP1 transformants showed blue color as did the colonies transformed with pGBKT7-atbZIP1 in the X-Gal staining for β-galactosidase activity (Figure ). Furthermore, the DLR assay system was used to confirm the transcriptional activation abilities of BnaA.bZIP1. The full-length BnaA.bZIP1 could activate the reporter gene but BnaA.bZIP1ΔC1 and BnaA.bZIP1ΔC2 failed to activate it, compared to the negative control pGAL4BD (Figure ).
Furthermore, the positive control AtbZIP1 could also activate the reporter gene, which had almost 1.4-fold LUC activity compared to the full-length BnaA.bZIP1. These results indicated that BnaA.bZIP1 exhibited similar transcriptional activity and the C terminus of BnaA.bZIP1 was necessary for its transcription activation activity. BnaA.bZIP1 Acts as a Transcriptional Repressor of BnaC.SP6 BnaA.bZIP1 belongs to bZIP TFs, which has been demonstrated that it can specifically recognize and bind to ACGT-containing elements in their target genes. Sequence analysis revealed that pBnaC.SP6 contained a C-box (CACGTC) and an ABRE motif (TACGTG) (Supplementary Figure S1). Moreover, BnaA.bZIP1 was coexpressed with BnaC.SP6 in anthers. These evidences imply that BnaA.bZIP1 might interact to the p BnaC.SP6.
Thus, we performed a yeast one-hybrid assay with p158, mutated p158, and p99 promoter regions to examine whether BnaA.bZIP1 could bind to the C-box or ABRE motif. All the co-transformed yeast cells grew well on SD/-Leu medium without Aureobasidin A (AbA) and the positive control p53 also grew well on SD-Leu medium with AbA (50 ng ml -1). Yeast cells co-transformed with pGADT7-BnaA.bZIP1 and pAbAi-p158 grew normally, but the yeast cells co-transformed with pGADT7-BnaA.bZIP1 and pAbAi-P99 or pAbAi-mp158 (with C-box sequence in the p158 changed from CACGTC to Ctatga) failed to survive on agar plates containing 50 ng ml -1 AbA (Figure ). This indicated that BnaA.bZIP1 specifically binds to the C-box but not to the ABRE motif in p158 promoter region in yeast. BnaA.bZIP1 binds to the p158 promoter region and acts as a transcriptional repressor. (A) Growth of the co-transformed yeast cells on SD/-Leu plates without or with AbA (50 or 100 ng ml -1). (B) Diagram of the p158 region.
The p158 region was divided into p103 and p99 regions, with a 43-bp overlap, containing putative C-box and ABRE motifs, respectively. The p59 and mp59 probes containing the C-box or mutated C-box were used for EMSA. The core sequence (CACGTC) of the C-box was changed to Ctatga (underlined). (C) Binding of BnaA.bZIP1 to the C-box of p158 region in EMSA. The BnaA.bZIP1-His protein was incubated with the Cy5-labeled probe containing the C-box or mutated C-box; the pET-32a-His protein was used as a negative control; the unlabeled promoter fragment was used as a competitor in the assay., absence; +, presence; black triangle indicates the shifted band; black arrows indicate reduced intensity of the shifted bands; a black star indicates the free probes. (D) Schematic representation of the constructs used for the dual luciferase reporter (DLR) assay in Arabidopsis protoplasts.
BnaA.bZIP1 driven by the CaMV35S promoter was used as an effector. For each reporter construct, the firefly LUC gene was driven by the p158, p103, mutated p158 (mp158), and mutated p103 (mp103) promoter, respectively. (E) The promoter activity was indicated by a ratio of LUC to REN as described in Figure ( n = 3). The value of the control was set to 1. Error bars represent the SE of three biological replicates.
When 100 ng ml -1 AbA was supplemented to the medium, only the p53 grew well on SD/-Leu medium (Figure ); thus, to further confirm the interaction of BnaA.bZIP1 with C-box, an electrophoretic mobility shift assay (EMSA) was performed with Cy5-labeled probes, p59 and mp59 (Figure ). The recombinant fusion protein, BnaA.bZIP1-His, was able to bind to the p59 probe, but failed to bind to the C-box-mutated probe, mp59. Furthermore, this specific binding could be reduced by competition with unlabeled probe at 200×, 400×, and 800× concentrations (Figure ).
The negative control, pET-32a-His, failed to bind to the p59 probe. These results strongly provide further support that BnaA.bZIP1 can directly bind to the C-box in the p158 region.
The results described above revealed that BnaA.bZIP1 has transcriptional activity; however, it was not clear whether it was an activator or a repressor. To determine this, a DLR assay using Arabidopsis protoplasts was performed to investigate how BnaA.bZIP1 interacts with the p158 region (Figure ). The presence of the effector 62-SK-BnaA.bZIP1 and the reporter 0800-p158-LUC resulted in a 50% reduction in LUC activity compared to that in the control, whereas such a reduction was not observed with the 0800-mp158-LUC reporter. Similar level of reduction in LUC activity was obtained for the combination of 62-SK-BnaA.bZIP1 and 0800-p103-LUC, but for 0800-mp103-LUC, the LUC activity was close to that in the control (Figure ). Thus, it was confirmed that BnaA.bZIP1 could specifically bind to the C-box sequence and suppress the p158 activity.
We also generated the stable transgenic plants expressing BnaA.bZIP1 with a dexamethasone (DEX)-inducible system in the background of p158 promoter transgenic line. QRT-PCR was performed to measure the suppression activity of BnaA.bZIP1 using total RNA from late buds of the DEX-inducible plants. Firstly, the expression level of BnaA.bZIP1 was induced to 37- and 154-fold higher than that in the control (Figure ), and the expression of GUS was decreased by 1.5-fold as expected (Figure ), which is consistent with the transient assay, indicating that BnaA.bZIP1 suppressed the activity of p158 (Figure ). Secondly, the expression of BnaC.SP6 homologous gene, ATSP6, was also decreased in the inducible plants (Figure ). Additionally, five genes ( LEA27, GGP1, ATPS2, CML24, and RIN4) which were previously characterized to be bound and repressed by AtbZIP1, were also detected. QRT-PCR results showed that the expression levels of these genes were consistently decreased in the inducible plants except for CML24 and RIN4 (Figures ). These results strongly supported that BnaA.bZIP1 acts as a transcriptional repressor of BnaC.SP6 in pollen activity.
QRT-PCR analyses of genes bound and repressed by AtbZIP1 in DEX-induced BnaA.bZIP1/p158 plants. The data were calculated according to the 2 -ΔΔ C t method and the mRNA levels of genes on 0 day were set to 1. Bars show means ± SD ( n = 3). The RNA samples from buds were tested on 0, 4, and 6 days after treatment with DEX. (A–H) Relative mRNA levels of BnaA.bZIP1, GUS ( Escherichia coli beta-glucuronidase gene), ATSP6 (At1g19500), LEA27 (LATE EMBRYOGENESIS ABUNDANT 27, At2g46140), GGP1 (GAMMA-GLUTAMYL PEPTIDASE 1, At4g30530), ATPS2 (PHOSPHATE STARVATION-INDUCED GENE 2, At1g73010), RIN4 (RPM1-interacting protein 4 family protein, At2g17660), and CML24 (CALMODULIN-LIKE 24, At5g37770). Discussion AtbZIP1 can directly bind to various ACGT-containing elements to regulate the expression of downstream genes. In this study, qRT-PCR and GUS staining showed that its homologous gene, BnaA.bZIP1 was predominantly expressed in whole anthers (Figures ).
BnaA.bZIP1 encoded a nuclear-localized bZIP-type DNA-binding protein and possessed transcriptional activation activity in the yeast and protoplast assay system (Figures ). Y1H showed that BnaA.bZIP1 could specifically bind to the C-box but not to the ABRE motif in p158 (Figure ). The ABRE motif was present in p158 but not in the -210 to -135 region, indicating that it was not necessary for the pollen-specific activity of p158. The EMSA and DLR assay results also showed that BnaA.bZIP1 interacted directly with p158 by binding to the CACGTC (C-box) element (Figures ).
In addition, we demonstrated that BnaA.bZIP1 could suppress the p158 activity in DEX-induced BnaA.bZIP1/p158 plants (Figure ). Thus, BnaA.bZIP1 functions as a transcriptional repressor of BnaC.SP6, providing evidence that a bZIP TF participates in pollen development. However, further study is needed to explore whether or not C-box is crucial for the pollen-specific activity of p158. In additional, the dramatically expression of BnaA.bZIP1 in flower organs implies that other factors might contribute to pollen-specific expression of BnaC.SP6. The bZIPs are known to form homodimers and heterodimers for DNA-binding and regulation of transcription (;; ).
The dimer composition determines the outcome of target gene expression. Two bZIP proteins, EEL and ABA-insensitive 5 (ABI5) act antagonistically on the same target promoter: ABI5 homodimers activate the gene expression, whereas EEL homodimers and ABI5–EEL heterodimers suppress it. Similarly, AtbZIP1 forms heterodimers with AtbZIP10 or AtbZIP63, which could improve its binding affinity for G-box and C-box cis-elements. Also confirmed that the potential homodimerization of AtbZIP18/AtbZIP18, AtbZIP28/AtbZIP28, AtbZIP60/AtbZIP60, and heterodimerization of AtbZIP61/AtbZIP18, AtbZIP18/AtbZIP34, bZIP28/bZIP60 by Y2H assays among the pollen-expressed bZIP TFs. AtbZIP18 possessed high dimerization capacity and acted as a repressor with its EAR (ethylene-responsive element binding factor-associated amphiphilic repression) motif in pollen development network.
Furthermore, the transactivation activity of the same bZIP can be further modified through its interaction with other proteins. HY5 (ELONGATED HYPOCOTYL 5) is enhanced by the clock protein CCA1, but is inhibited when it interacts with BBX25 (; ). Other TFs family could also form homodimers or heterodimers to regulate downstream gene expression, such as MADS-box TFs of the MIKC ∗ class.
For example, AGL65, AGL66, AGL94, and AGL104 could form three heterodimers and repress early genes at late stages of pollen development. In our study, BnaA.bZIP1 possessed transcription activation activity but suppressed the pollen activity of BnaC.SP6. These results imply that BnaA.bZIP1 might interact with other bZIPs to suppress the expression of BnaC.SP6 by binding to the C-box. Arabidopsis has been widely used to effectively characterize the cis-elements of the anther/pollen-specific promoters for homologous and heterologous crop plant species (;; ). In our study, the activities of pBnaC.SP6 deletions were analyzed in Arabidopsis. The discrete reduction in GUS activity of the pBnaC.SP6 deletion constructs implies that the cis-elements are complicated (Supplementary Figure S2B). We showed that the -447 to -375 and -210 to -135 regions are essential for the silique septum and pollen expression of BnaC.SP6, respectively (Figure ).
The -447 to -375 region lacks any known cis-acting elements required for silique septum-specific expression. One putative Skn1-motif is absent in the -447 to -375 region. However, there was nearly fourfold reduction in GUS activity in the case of p375 where we deleted the -447 to -375 region (Supplementary Figure S2B). This suggests that some novel cis-acting elements, which can control BnaC.SP6 expression in the silique septum, are located within the -447 to -375 region. Identified that γMYB1 binds to the P1BS cis-element, and activates the expression of PLA2-γ with the assistance of its co-activator, γMYB2.
When we deleted the -306 to -210 region containing a P1BS, p210 exhibited a 1.90-fold decrease in GUS activity compared to that observed for p306. This implies that P1BS contributes to the pollen activity of p306, which might also be activated by γMYB1. In this study, p375, p254, and p210, which were confirmed to be anther-specific promoters in Arabidopsis, could be used in generating the transgenic male sterility lines in B. In addition, constructed a male sterility system for hybrid breeding and seed production in rice using three modules consisting of a restorer gene, OsNP1, the red fluorescence protein gene, DsRed, and the maize α-amylase gene, ZM-AA1, under the pollen-specific PG47 promoter. S45AB of rape ( B. Napus L.) is a recessive genic male sterile line just like the osnp1-1 mutant of rice. Therefore, similar seed production technology system of S45AB can be constructed in B.
Napus using the late pollen-specific promoter p158 fusing with ZM-AA1 to specifically kill the 50% transgenic pollen. However, further analyses are needed.
Conclusion We confirmed that two short promoter regions independently control the specificity of BnaC.SP6. BnaA.bZIP1 could interact to C-box and function as a transcriptional repressor of BnaC.SP6. These findings provide new insight into the regulator of BnaC.SP6 and the pollen/anther-specific regions of pBnaC.SP6, which should have potential application in genetic manipulation. However, further evaluation is needed for use in the genetic engineering of B. Author Contributions JT and XW designed the study. XW prepared materials, performed most of experiments, and wrote the original manuscript. Other authors assisted in experiments and discussed the results.
Funding This work was financed by the National Key Research and Development Program of China (grant number 2016YFD0101300). Conflict of Interest Statement The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgment The authors thank Prof.
Liwen Jiang (State Key Laboratory of Agrobiotechnology, Chinese University of Hong Kong) for providing pTA7002 vector. Supplementary Material The Supplementary Material for this article can be found online at: References. Reviewed by:, Institute of Experimental Botany (ASCR), Czechia, Northwest A&F University, China Copyright © 2017 Wang, Li, Li, Wen, Yi, Shen, Ma, Fu and Tu. This is an open-access article distributed under the terms of the. The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Correspondence: Jinxing Tu.